Python Library

I'm new for python and kivy, and struggling with them. I wanted to implement drag and drop func… Read more Usage Of Dragbehavior In Kivy

I am trying to use NumPy in Python. I have just installed Anaconda Python 3.7, and that all seemed … Read more How To Get Numpy Working Properly In Anaconda Python 3.7.6

I have quite a big program which has a CLI interaction based on argparse, with several sub parsers.… Read more Argparse On Demand Imports For Types, Choices Etc

Log of asterisk after call is as follows: AGI Tx >> agi_channel: SIP/AC_221-00000007 AGI Tx &… Read more Asterisk Is Not Executing Python File Using Agi

from PyQt5.QtWidgets import QApplication, QLabel, QWidget, QFileDialog, QPushButton, QLineEdit,QVBo… Read more How Do I Open An Image In A Separate Window Using A Button Click In Pyqt5?

I'm using python3 + PyQt5. In my program I have QCombobox and a QTreeView inside that combobox.… Read more Preventing Qcomboboxview From Autocollapsing When Clicking On Qtreeview Item

I'm trying to get Python Selenium to work on my Windows Machine. I've upgraded to the lates… Read more How To Load Firefox Profile With Python Selenium?

I am concerned with a script that involves datetime module. I have to suppress 'object received… Read more Suppress Django Naive Datetime Warnings

my first post here! I have problems using the nltk NaiveBayesClassifier. I have a training set of 7… Read more Nltk Naive Bayesian Classifier Memory Issue

When I try to install any .WHL from gohike by typing into the cmd C:\Users\owner\Downloads>pip i… Read more Pip Wont Install .whl Files

I have apache 2.4 installed (64 bit), python 3.7 (64 bit) (installed from Anaconda, if that matters… Read more Can't Build Mod_wsgi On Windows 10 - "cannot Open Include File: 'ws2tcpip.h'" - Have Vs 2019 Build Tools

This is part of my code for a guessing game. I want to count the guesses of a player, and then appe… Read more My Program Only Appends One User Input To List When Main Is Looped

I'm trying to import xml.dom.minidom but pycharm doesn't find it, altough it finds xml.entr… Read more I Can't Import Xml.dom.minidom In Pycharm. What Could I Try?

I want to run this command with variables inside a subprocess in a script. The variable is: filenam… Read more Command Line With Variables In Subprocess

I'm having a problem with encoding in my application and didn't find the solution anywhere … Read more Encoding On Postgresql, Python, Jinja2

I tried to do a 3D scatter plot in Python with string categories (i.e. activation functions and sol… Read more 3d Scatterplot With Strings In Python

I am trying to get a oracle sqlalchemy dburi working with an external password store (Oracle Wallet… Read more Using Sqlalchemy Dburi With Oracle Using External Password Store?

I'm working on writing some constraints for a class method using PyContract (not PyContracts). … Read more Referencing `self` In `__old__` In Pycontract Constraints

I want to use Python and cv2 to compare 2 images, like below. (Python 2.7 + Windows) c:\Original.jp… Read more To Use Opencv/cv2 To Compare And Mark The Difference Between 2 Images (with Pictures)

Dataframe: id Base field1 field2 field3 1 Y AA BB CC 1 N … Read more Group Pandas Dataframe & Validate With Condition

Hi I'm a 11 year old who has taken up python as a hobby. I'm trying to make a mass converte… Read more Typeerror: Can't Multiply Sequence By Non-int Of Type 'float' Python 2.7

I use python ftplib to connect to a ftp server which is running on active mode; That means the serv… Read more How Can I Specify The Client's Data Port For A Ftp Server In Active Mode?

I have this code: def block_stacks(num): stack = cmds.group(empty=True, name='Stacks#')… Read more What Does It Mean For An Object To Be "in The Underworld?"

In my dataframe, I get a '2' written over my index column's name. when I check for the … Read more How To Remove The Index Name In Pandas Dataframe?

I have the following HelloWorld project using Python 3 and cherrypy that serves 2 matplotlib images… Read more How To Serve Multiple Matplotlib Images From Cherrypy?

I have the following list of dictionaries: [{'Sequence': 'TGACCCTGCTTGGCGATCCCGGCGTTTC&… Read more Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

def GetSale():#calculates expected sale value and returns info on the stock with highe… Read more How To Iterate Over Two Dictionaries At Once And Get A Result Using Values And Keys From Both

I have this image: What I am trying to do is to detect the center of mass of the inner contour (nu… Read more Center Of Mass In Contour (python, Opencv)

I have the following script that generates a combo box (Select) and a plot: import bokeh.plotting a… Read more Specify Position Of Combo Box

.I've been dealing with list comprehension recently, I came across a problem I can't seem t… Read more Python Construction Of Value Set Dictionary

Related to this similar question for Pandas: filtering grouped df in pandas Action To eliminate gro… Read more Filtering Grouped Df In Dask

I am dealing with name disambiguation issues. I'm wondering if there's a way to find all co… Read more What Is One Way To Find Related Names Using The Web?

I have a Category class and there is a ledger attribute for each instance of this class. This ledge… Read more How To Store The Total Withdrawal Amount For Each Category Object?

I have a Python script that needs to execute an external program, but for some reason fails. If I h… Read more How Do I Execute A Program From Python? Os.system Fails Due To Spaces In Path

A few times I accidentally modified the input to a function. Since Python has no constant reference… Read more Python: Unintentionally Modifying Parameters Passed Into A Function

I built a python module and I want to import it in my pyspark application. My package directory str… Read more Pyspark Import User Defined Module Or .py Files

I'm storing some variables in the session when the user logs in, to use later to populate a fie… Read more What Is The Correct Way To Populate Fields From Database Or Session Data?

I'm trying to install numpy on my Mac. I'm currently using OS X 10.7.3 and Python version 2… Read more How To Install Numpy With Pip

I downloaded the Windows x86-64 embeddable zip file from https://www.python.org/downloads/release/p… Read more How To Install Python Using The "embeddable Zip File"

Im using mysql in my windows7 for a year and its working fine. I recently know about django and try… Read more Setting Up Django Setting.py With Mysql Database

Several years ago I created a small Python program which were able to maintain my calendar using oa… Read more How Do I Use Google.auth Instead Of Oauth2client In Python To Get Access To My Google Calendar

So I know how to import a texfile and sort numbers such as: 1 6 4 6 9 3 5 But I don't know how… Read more Python Sorting A Text File?

I know this is a basic question. But, please hear me out. I have below dataframes: In [722]: m1 Out… Read more Pandas: Best Way To Join Two Dataframes Based On A Common Column

I created a CNN-LSTM for survival prediction of web sessions, my training data looks as follows: pr… Read more Cnn-lstm Timeseries Input For Timedistributed Layer

I am looking for a way to rescale a numpy 2D array to arbitrary dimensions in such a way that each … Read more Resample 2d Numpy Array To Arbitrary Dimensions

I want to run a python program using sudo (e.g. sudo python test.py) but within the python program … Read more Invoke Os.system As A Non-root User In A Root-user Launched Python Program

I save images in numpy array of size 5000,96,96 into .mat file using scipy.io.savemat(). When I wa… Read more Convert Loaded Mat File Back To Numpy Array

Hope you are good I m trying to make an simple script but I got stuck on there I am trying to scrol… Read more How To “scroll Down” Some Part Using Selenium In Python?

I have a list property tag_list = db.StringListProperty() This has been working fine so far, but t… Read more Why Do I Get "too Many Indexed Properties For Entity" Error Just For 18 Items In The List? (python)

i have already read an image as an array : import numpy as np from scipy import misc face1=misc.imr… Read more Fastest Way To Iterate Over All Pixels Of An Image In Python

I am attempting to output the contents of a text file to a discord channel via Discord. The issue I… Read more Python Discord.py Ways To Split Output To Bypass 2000 Character Limit

In this example we have two days of data sampled at a resolution of 1min, giving us 2880 measuremen… Read more Calculate Mean Sales Per Minute Accross 24-hour Cycles As Per Local-time (hh:mm)

Assuming you using Python JSL library for defining JSON schema of your data and you using attrs lib… Read more How To Materialize Attrs Data Class From Json Schema Defined By Jsl Document

Kivy Python does not support Bengali joining characters,Is there any other way to solve this proble… Read more Kivy Isn't Showing (bengali) Joining Character Properly?

I have a python code which have the following 3rd party dependencies: import boto3 from warcio.arch… Read more Spark-submit Fails To Detect The Installed Modulus In Pip

I'm able to send requests to one of our gRPC-enabled, reflection-enabled server using grpcurl w… Read more Send Plain Json To A Grpc Server Using Python

I've been getting blank json files despite successfully being able to execute most of the lines… Read more Scrapy Scrapes Data But No Output To File

I am trying to fetch a list from a php file using python and save it to a file: import urllib.reque… Read more Write Contents Of Url Request To File