Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

I have the following list of dictionaries: [{'Sequence': 'TGACCCTGCTTGGCGATCCCGGCGTTTC', 'Start': '52037', 'Strand': '+', 'End': '52064'}, {'Sequence': 'TGATCGCGCAACTGCAGCGGGAGTTAC

Solution 1:

You could use .format_map(each_dic) or later Python 3.5+ added alternative .format(**each_dic). Uses each dict in the list in each print with formatting.

for each_dic in dictList:
    print('Sequence: {Sequence:<29} ''Start: {Start:>7} ''Strand: {Strand} ''End: {End:>7}'.format_map(each_dic))

Look at Python help page: string - Common string operations for further reference and examples.

Solution 2:

Avoid new lines by simply specifying the ending with:

print("Start"+item.get('Start'), end=" ")

end=" " will continue your string without new lines

Solution 3:

Taken from my update, inspired by Aleksey Solovey

print(ecf+"  "+replicon+"  -  "+"Validated results: Total number of hits: "+str(len(finalList)))
print("")

for item in finalList:
    print("Start: "+str(item.get('Start'))+"  "+"End: "+str(item.get('End'))+"  "+"Strand: "+str(item.get('Strand'))+"  "+"Sequence: "+str(item.get('Sequence')))