Skip to content Skip to sidebar Skip to footer
Showing posts with the label Output
Modify For List Output In Recursion

Modify For List Output In Recursion

Post a Comment
In Find all possible combinations that overlap by end and start, we get the following program that … Read more Modify For List Output In Recursion
Redirect An Output Command To A Variable Or File?

Redirect An Output Command To A Variable Or File?

Post a Comment
I'm trying to write a python script that will allow me to take the output from a command and to… Read more Redirect An Output Command To A Variable Or File?
Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

Post a Comment
I have the following list of dictionaries: [{'Sequence': 'TGACCCTGCTTGGCGATCCCGGCGTTTC&… Read more Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout
Write A Program To Check The Overlapping Of One String's Suffix With The Prefix Of Another String

Write A Program To Check The Overlapping Of One String's Suffix With The Prefix Of Another String

Post a Comment
a = input() b = input() def longestSubstringFinder(string1, string2): answer = '' … Read more Write A Program To Check The Overlapping Of One String's Suffix With The Prefix Of Another String
How Do I Save Output Into A Text File In Python?

How Do I Save Output Into A Text File In Python?

Post a Comment
So what I want to do is save the output of this program into a text file. import itertools res = i… Read more How Do I Save Output Into A Text File In Python?
How To Print Out Elements Of Tuple One Per Line

How To Print Out Elements Of Tuple One Per Line

Post a Comment
Below is my code for a DNA string neighboring question: chars = 'ACGT' def neighbors(patt… Read more How To Print Out Elements Of Tuple One Per Line